Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757334

Xenopus ORFeome
What is the ORFeome?

ORF Name:actb ORF2 Species: tropicalis
Gene Symbol: actb Entrez Gene ID: 407952
Gene Synonyms: beta actin, beta-actin
Gene Name: actin, beta
Description: cytoskeletal constituent
Plate: GDExt11012 Well: C12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133687.1
ORF Translation: ATO95039.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis actin, beta, mRNA (cDNA clone MGC:79692 IMAGE:6980855), complete cds
Template Accession: BC082343
GI: 52078366
Clone ID: IMAGE:6980855
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGACGATATTGCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCATTTACGATGCACTATTGA


Publications
First:
Most recent:
View All Papers