Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757339

Xenopus ORFeome
What is the ORFeome?

ORF Name:actc1 ORF1 Species: tropicalis
Gene Symbol: actc1 Entrez Gene ID: 394698
Gene Synonyms: actc, actna1, cardiac actin, cardiac alpha actin, muscle actin
Gene Name: actin, alpha, cardiac muscle 1
Description: cytoskeletal constituent
Plate: GDExt11002 Well: F07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132859.1
ORF Translation: ATO94211.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis actin, alpha, cardiac muscle 1, mRNA (cDNA clone MGC:75679 IMAGE:5380133), complete cds
Template Accession: BC062494
GI: 38382922
Clone ID: IMAGE:5380133
Tissue: whole organism
Stage: NF stage 40 to NF stage 45
Clone Library: NICHD_XGC_Emb8
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGACGACGAGGAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCACTTCCTGTGCACAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556