Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757374

Xenopus ORFeome
What is the ORFeome?

ORF Name:actr3 ORF1 Species: tropicalis
Gene Symbol: actr3 Entrez Gene ID: 394999
Gene Synonyms: arp3
Gene Name: ARP3 actin-related protein 3 homolog
Description: Actin-related protein Arp2/3 complex, subunit Arp3
Plate: GDExt11001 Well: A04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132718.1
ORF Translation: ATO94070.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ARP3 actin-related protein 3 homolog, mRNA (cDNA clone MGC:76155 IMAGE:5335317), complete cds
Template Accession: BC064225
GI: 39849984
Clone ID: IMAGE:5335317
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCGGCTCCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGACATGACACCGAACAC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556