Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757694

Xenopus ORFeome
What is the ORFeome?

ORF Name:aldh1a1 ORF1 Species: tropicalis
Gene Symbol: aldh1a1 Entrez Gene ID: 613078
Gene Synonyms: aldc, aldh-e1, aldh1, aldh11, pumb1, raldh1
Gene Name: aldehyde dehydrogenase 1 family member A1
Description: Aldehyde dehydrogenase
Plate: GDExt11024 Well: B07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134689.1
ORF Translation: ATO96041.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis aldehyde dehydrogenase 1 family, member A1, mRNA (cDNA clone MGC:107771 IMAGE:7007049), complete cds
Template Accession: BC096010
GI: 66364847
Clone ID: IMAGE:7007049
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGAGAAAACCCTTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAATTCTTCTGTGAAATTTTCAT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556