Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757699

Xenopus ORFeome
What is the ORFeome?

ORF Name:aldh2 ORF1 Species: tropicalis
Gene Symbol: aldh2 Entrez Gene ID: 448267
Gene Synonyms:
Gene Name: aldehyde dehydrogenase 2 family member
Description: oxidoreductase
Plate: GDExt11017 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134159.1
ORF Translation: ATO95511.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis aldehyde dehydrogenase 2 family (mitochondrial), mRNA (cDNA clone MGC:89020 IMAGE:7004710), complete cds
Template Accession: BC075335
GI: 49522567
Clone ID: IMAGE:7004710
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCCGGACAGCCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAATTCTTCTGGGGAATCT


Publications
First:
Most recent:
View All Papers