Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757884

Xenopus ORFeome
What is the ORFeome?

ORF Name:ankrd2 ORF1 Species: tropicalis
Gene Symbol: ankrd2 Entrez Gene ID: 100037897
Gene Synonyms: ankrd2-a, ankrd2-b, arpp
Gene Name: ankyrin repeat domain 2 (stretch responsive muscle)
Description: Myotrophin and similar proteins
Plate: GDExt11040 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135945.1
ORF Translation: ATO97297.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100037897, mRNA (cDNA clone MGC:121289 IMAGE:7601509), complete cds
Template Accession: BC135222
GI: 134025734
Clone ID: IMAGE:7601509
Tissue: whole organism
Stage:
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGAAGTGAAATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTGCTTCTCTGAAATGTTGTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556