Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757914

Xenopus ORFeome
What is the ORFeome?

ORF Name:anks1a ORF1 Species: tropicalis
Gene Symbol: anks1a Entrez Gene ID: 100127665
Gene Synonyms:
Gene Name: ankyrin repeat and sterile alpha motif domain containing 1A
Description: CASK-interacting adaptor protein (caskin) and related proteins with ankyrin repeats and SAM domain
Plate: GDExt11046 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136494.1
ORF Translation: ATO97846.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100127665, mRNA (cDNA clone MGC:173031 IMAGE:7654987), complete cds
Template Accession: BC154104
GI: 158253666
Clone ID: IMAGE:7654987
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAAGAACAGGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTTTTCATCCATTGCCC


Publications
First:
Most recent:
View All Papers