Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757919

Xenopus ORFeome
What is the ORFeome?

ORF Name:anp32b ORF1 Species: tropicalis
Gene Symbol: anp32b Entrez Gene ID: 594955
Gene Synonyms: phapi2, ssp29
Gene Name: acidic nuclear phosphoprotein 32 family member B
Description: Leucine-rich acidic nuclear protein
Plate: GDExt11019 Well: C01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134248.1
ORF Translation: ATO95600.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis MGC69373 protein, mRNA (cDNA clone MGC:69373 IMAGE:5335185), complete cds
Template Accession: BC090607
GI: 60618390
Clone ID: IMAGE:5335185
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACATGAAAAAACGAATCCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCATCCTCTTCATCACCA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556