Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758034

Xenopus ORFeome
What is the ORFeome?

ORF Name:ap2m1 ORF1 Species: tropicalis
Gene Symbol: ap2m1 Entrez Gene ID: 394572
Gene Synonyms: clapm1
Gene Name: adaptor related protein complex 2 subunit mu 1
Description:
Plate: GDExt11004 Well: C12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133014.1
ORF Translation: ATO94366.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis adaptor protein complex AP-2, mu1, mRNA (cDNA clone MGC:75936 IMAGE:5383841), complete cds
Template Accession: BC061374
GI: 38174422
Clone ID: IMAGE:5383841
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTGGGGGACTGTTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACACCGTGTCTCATAGATCC


Publications
First:
Most recent:
View All Papers