Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758074

Xenopus ORFeome
What is the ORFeome?

ORF Name:apcs ORF1 Species: tropicalis
Gene Symbol: apcs Entrez Gene ID: 493537
Gene Synonyms: ptx2, sap
Gene Name: amyloid P component, serum protein
Description:
Plate: GDExt11017 Well: H08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134131.1
ORF Translation: ATO95483.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis apcs protein, mRNA (cDNA clone MGC:89065 IMAGE:7005765), complete cds
Template Accession: BC082494
GI: 51950252
Clone ID: IMAGE:7005765
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAGATATGTCCTGTGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTTTCATTGCATGAAGAAAGCAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556