Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758084

Xenopus ORFeome
What is the ORFeome?

ORF Name:apex2 ORF1 Species: tropicalis
Gene Symbol: apex2 Entrez Gene ID: 448512
Gene Synonyms: ape2, apexl2, xth2
Gene Name: apurinic/apyrimidinic endodeoxyribonuclease 2
Description: DNA repair
Plate: GDExt11011 Well: D04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133620.1
ORF Translation: ATO94972.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis APEX nuclease (apurinic/apyrimidinic endonuclease) 2, mRNA (cDNA clone MGC:79651 IMAGE:6980251), complete cds
Template Accession: BC076676
GI: 49903338
Clone ID: IMAGE:6980251
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGATTGTGAGTTGGAACATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTCACCTCCAGCTT


Publications
First:
Most recent:
View All Papers