Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758134

Xenopus ORFeome
What is the ORFeome?

ORF Name:aqp1 ORF1 Species: tropicalis
Gene Symbol: aqp1 Entrez Gene ID: 448309
Gene Synonyms: aquaporin 1, aquaporin-1, aquaporin1, chip28
Gene Name: aquaporin 1 (Colton blood group)
Description: integral membrane pore (water channel) protein
Plate: GDExt11017 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134227.1
ORF Translation: ATO95579.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis aquaporin 1 (Colton blood group), mRNA (cDNA clone MGC:89110 IMAGE:7006583), complete cds
Template Accession: BC075384
GI: 49670646
Clone ID: IMAGE:7006583
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAGTGAGCTGAAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTGGCTTCATTTCCACCC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556