Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758194

Xenopus ORFeome
What is the ORFeome?

ORF Name:arg1 ORF1 Species: tropicalis
Gene Symbol: arg1 Entrez Gene ID: 448358
Gene Synonyms:
Gene Name: arginase 1
Description: Arginase
Plate: GDExt11018 Well: H06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134203.1
ORF Translation: ATO95555.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis arginase, liver, mRNA (cDNA clone MGC:89217 IMAGE:7017429), complete cds
Template Accession: BC075440
GI: 49670653
Clone ID: IMAGE:7017429
Tissue: whole organism
Stage: frog
Clone Library: NICHD_XGC_Swb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTAGCCAAGCAAAGACC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATATAATATCTGGAAGTGTCATTGT


Publications
First:
Most recent:
View All Papers