Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758364

Xenopus ORFeome
What is the ORFeome?

ORF Name:arr3 ORF1 Species: tropicalis
Gene Symbol: arr3 Entrez Gene ID: 100124859
Gene Synonyms:
Gene Name: arrestin 3, retinal (X-arrestin)
Description: Arrestin
Plate: GDExt11043 Well: G04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136186.1
ORF Translation: ATO97538.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100124859, mRNA (cDNA clone MGC:122040 IMAGE:7609414), complete cds
Template Accession: BC135571
GI: 134024069
Clone ID: IMAGE:7609414
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGGTTCCAAGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATACGACACCAGCATTCCCA


Publications
First:
Most recent:
View All Papers