Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758781

Xenopus ORFeome
What is the ORFeome?

ORF Name:bax ORF1 Species: tropicalis
Gene Symbol: bax Entrez Gene ID: 394793
Gene Synonyms: bax-a, loc108696744, xbax, xlbax
Gene Name: BCL2-associated X protein
Description: regulator of cell death/apoptosis
Plate: GDExt11001 Well: A10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132751.1
ORF Translation: ATO94103.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis BCL2-associated X protein, mRNA (cDNA clone MGC:76049 IMAGE:5307187), complete cds
Template Accession: BC063201
GI: 38649102
Clone ID: IMAGE:5307187
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACACACGGAGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGACATCTTCCAGATGGCAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556