Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758951

Xenopus ORFeome
What is the ORFeome?

ORF Name:bmp7.1 ORF1 Species: tropicalis
Gene Symbol: bmp7.1 Entrez Gene ID: 394805
Gene Synonyms: bmp-7, bmp7, op-1
Gene Name: bone morphogenetic protein 7, gene 1
Description: TGF-beta related peptide growth factor
Plate: GDExt11010 Well: F02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133502.1
ORF Translation: ATO94854.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis bone morphogenetic protein 7, gene 1, mRNA (cDNA clone MGC:76016 IMAGE:5384686), complete cds
Template Accession: BC063373
GI: 38648997
Clone ID: IMAGE:5384686
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGTTCTGCAAAAGAACAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGCAGCCGCAGGCCC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556