Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19758956

Xenopus ORFeome
What is the ORFeome?

ORF Name:bmp7.2 ORF1 Species: tropicalis
Gene Symbol: bmp7.2 Entrez Gene ID: 619363
Gene Synonyms: bmp7
Gene Name: bone morphogenetic protein 7, gene 2
Description: TGF-beta related peptide growth factor
Plate: GDExt11034 Well: A09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135510.1
ORF Translation: ATO96862.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis bone morphogenetic protein 7, gene 2, mRNA (cDNA clone MGC:146868 IMAGE:7824743), complete cds
Template Accession: BC121993
GI: 112418553
Clone ID: IMAGE:7824743
Tissue: ovary
Stage:
Clone Library: NIH_XGC_tropOva1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGCTTTGATAGTAAAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGGCATCCACATGCTTGAA


Publications
First:
Most recent:
View All Papers