Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759021

Xenopus ORFeome
What is the ORFeome?

ORF Name:bpgm ORF1 Species: tropicalis
Gene Symbol: bpgm Entrez Gene ID: 549353
Gene Synonyms:
Gene Name: bisphosphoglycerate mutase
Description: Phosphoglycerate mutase
Plate: GDExt11038 Well: D04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135793.1
ORF Translation: ATO97145.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC549353, mRNA (cDNA clone MGC:122624 IMAGE:7657917), complete cds
Template Accession: BC136118
GI: 134025822
Clone ID: IMAGE:7657917
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAAAATATAAACTTGTTATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTATCATTAGGCTTCACTTTTCC


Publications
First:
Most recent:
View All Papers