Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759631

Xenopus ORFeome
What is the ORFeome?

ORF Name:ccnb1.2 ORF1 Species: tropicalis
Gene Symbol: ccnb1.2 Entrez Gene ID: 394726
Gene Synonyms: ccnb, ccnb, cyclin b
Gene Name: cyclin B1
Description: cell cycle regulator
Plate: GDExt11010 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133510.1
ORF Translation: ATO94862.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis cyclin B1, mRNA (cDNA clone MGC:76039 IMAGE:5385019), complete cds
Template Accession: BC061430
GI: 38512080
Clone ID: IMAGE:5385019
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGCTGCGTATCACCAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGAGTGGGCGGGCCAA


Publications
First:
Most recent:
View All Papers