Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759666

Xenopus ORFeome
What is the ORFeome?

ORF Name:ccno ORF1 Species: tropicalis
Gene Symbol: ccno Entrez Gene ID: 407893
Gene Synonyms: ccnu, cyclin-o, udg2, ung2
Gene Name: cyclin O
Description: Cyclin B and related kinase-activating proteins
Plate: GDExt11007 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133244.1
ORF Translation: ATO94596.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC69220, mRNA (cDNA clone MGC:69220 IMAGE:5307654), complete cds
Template Accession: BC067943
GI: 45709705
Clone ID: IMAGE:5307654
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGACCTGTAGCATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTCCACTTTGATACTCCTG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556