Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759756

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdc37 ORF1 Species: tropicalis
Gene Symbol: cdc37 Entrez Gene ID: 548666
Gene Synonyms:
Gene Name: cell division cycle 37
Description: Cell division cycle 37 protein, CDC37
Plate: GDExt11045 Well: C09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136378.1
ORF Translation: ATO97730.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis CDC37 cell division cycle 37 homolog (S. cerevisiae), mRNA (cDNA clone MGC:121774 IMAGE:7633770), complete cds
Template Accession: BC135957
GI: 134026123
Clone ID: IMAGE:7633770
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGATTATAGCGTGTGGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCAGCAGCTTCACTCTT


Publications
First:
Most recent:
View All Papers