Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759890

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdk18 ORF1 Species: tropicalis
Gene Symbol: cdk18 Entrez Gene ID: 448581
Gene Synonyms: pctaire, pctaire3, pctk3
Gene Name: cyclin-dependent kinase 18
Description: serine/threonine kinase
Plate: GDExt11017 Well: D10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134100.1
ORF Translation: ATO95452.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis PCTAIRE protein kinase 3, mRNA (cDNA clone MGC:89093 IMAGE:7006264), complete cds
Template Accession: BC076915
GI: 49903482
Clone ID: IMAGE:7006264
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAAGGTGAAGAATTTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATATGCTCTGTCTTCTGGCCT


Publications
First:
Most recent:
View All Papers