Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759895

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdk2 ORF1 Species: tropicalis
Gene Symbol: cdk2 Entrez Gene ID: 493498
Gene Synonyms: eg1
Gene Name: cyclin-dependent kinase 2
Description: Protein kinase PCTAIRE and related kinases
Plate: GDExt11015 Well: E09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133945.1
ORF Translation: ATO95297.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis MGC89594 protein, mRNA (cDNA clone MGC:89594 IMAGE:6994839), complete cds
Template Accession: BC081346
GI: 51704176
Clone ID: IMAGE:6994839
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAATTTCCAGAAGGTGGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATCAGATGCGGAGTTGGT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556