Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759910

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdk5 ORF2 Species: tropicalis
Gene Symbol: cdk5 Entrez Gene ID: 780236
Gene Synonyms:
Gene Name: cyclin-dependent kinase 5
Description: early-expressed neuronal cyclin-dependent kinase
Plate: GDExt11045 Well: A08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136428.1
ORF Translation: ATO97780.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis cyclin-dependent kinase 5, mRNA (cDNA clone MGC:121845 IMAGE:7639181), complete cds
Template Accession: BC135926
GI: 138519724
Clone ID: IMAGE:7639181
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGAAGTACGAGAAGCTGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGGGGGCAAAAGTCAGCA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556