Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759915

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdk5 ORF1 Species: tropicalis
Gene Symbol: cdk5 Entrez Gene ID: 780236
Gene Synonyms:
Gene Name: cyclin-dependent kinase 5
Description: early-expressed neuronal cyclin-dependent kinase
Plate: GDExt11033 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135355.1
ORF Translation: ATO96707.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis cyclin-dependent kinase 5, mRNA (cDNA clone MGC:145955 IMAGE:7666061), complete cds
Template Accession: BC118780
GI: 110645529
Clone ID: IMAGE:7666061
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGAAGTACGAGAAGCTGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGGGGGCAAAAGTCAGCA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556