Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759935

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdk8 ORF1 Species: tropicalis
Gene Symbol: cdk8 Entrez Gene ID: 394856
Gene Synonyms:
Gene Name: cyclin-dependent kinase 8
Description: Cyclin C-dependent kinase CDK8
Plate: GDExt11001 Well: D12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132778.1
ORF Translation: ATO94130.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis cell division cycle 2-like 6 (CDK8-like), mRNA (cDNA clone MGC:76204 IMAGE:5336065), complete cds
Template Accession: BC063921
GI: 39645670
Clone ID: IMAGE:5336065
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACTATGACTTCAAGGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACCGGTGGGTCTGAT


Publications
First:
Most recent:
View All Papers