Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19759975

Xenopus ORFeome
What is the ORFeome?

ORF Name:cdx2 ORF1 Species: tropicalis
Gene Symbol: cdx2 Entrez Gene ID: 394817
Gene Synonyms: cad2, cdx-2, cdx3-like, xcad2, xcaudal2
Gene Name: caudal type homeobox 2
Description: homeodomain transcription factor
Plate: GDExt11005 Well: F02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133041.1
ORF Translation: ATO94393.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis caudal type homeobox 2, mRNA (cDNA clone MGC:75839 IMAGE:5382575), complete cds
Template Accession: BC063344
GI: 38648966
Clone ID: IMAGE:5382575
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACGTGAGTTACTTGTTGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTGTGACAGTATTAGGCAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556