Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19760070

Xenopus ORFeome
What is the ORFeome?

ORF Name:ces2 ORF1 Species: tropicalis
Gene Symbol: ces3.4 Entrez Gene ID: 779633
Gene Synonyms: ce-2, ces2, ces2a1, esterase, pce-2
Gene Name: carboxylesterase 3, gene 4
Description: Carboxylesterase and related proteins
Plate: GDExt11017 Well: C12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134208.1
ORF Translation: ATO95560.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC89138, mRNA (cDNA clone MGC:89138 IMAGE:7007460), complete cds
Template Accession: BC082503
GI: 51950112
Clone ID: IMAGE:7007460
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATCCCTGATCAAAGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGCTGTACACGTTCTCC


Publications
First:
Most recent:
View All Papers