Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19760135

Xenopus ORFeome
What is the ORFeome?

ORF Name:cfp ORF1 Species: tropicalis
Gene Symbol: cfp Entrez Gene ID: 496476
Gene Synonyms: bfd, pfc, pfd, properdin
Gene Name: complement factor properdin
Description: metalloendopeptidase
Plate: GDExt11023 Well: C07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134601.1
ORF Translation: ATO95953.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis properdin factor, complement, mRNA (cDNA clone MGC:88949 IMAGE:7002875), complete cds
Template Accession: BC084446
GI: 54038211
Clone ID: IMAGE:7002875
Tissue: whole organism
Stage: frog
Clone Library: NICHD_XGC_Swb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCCTCCTGTCGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCACTCAATCACATTTTTACACTC


Publications
First:
Most recent:
View All Papers