Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19760416

Xenopus ORFeome
What is the ORFeome?

ORF Name:clk2 ORF1 Species: tropicalis
Gene Symbol: clk2 Entrez Gene ID: 496828
Gene Synonyms:
Gene Name: CDC like kinase 2
Description: dual specificity protein kinase
Plate: GDExt11021 Well: A02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134438.1
ORF Translation: ATO95790.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis CDC-like kinase 2, mRNA (cDNA clone MGC:97637 IMAGE:6979877), complete cds
Template Accession: BC088525
GI: 56788837
Clone ID: IMAGE:6979877
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGCACTCCAGGCGGTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCGGCTGATGTCCCGGCCA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.3


Major funding for Xenbase is provided by grant P41 HD064556