Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19760421

Xenopus ORFeome
What is the ORFeome?

ORF Name:clk3 ORF1 Species: tropicalis
Gene Symbol: clk3 Entrez Gene ID: 496952
Gene Synonyms:
Gene Name: CDC like kinase 3
Description: dual-specificity kinase
Plate: GDExt11022 Well: F05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134558.1
ORF Translation: ATO95910.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis CDC-like kinase 3, mRNA (cDNA clone MGC:97791 IMAGE:6990221), complete cds
Template Accession: BC088580
GI: 56972008
Clone ID: IMAGE:6990221
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCACAGAAGAAAGAGGTATTGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTGCTGAGGTCTCTTGAGATT


Publications
First:
Most recent:
View All Papers