Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19760506

Xenopus ORFeome
What is the ORFeome?

ORF Name:cnbp ORF1 Species: tropicalis
Gene Symbol: cnbp Entrez Gene ID: 448166
Gene Synonyms: cnbp1, dm2, promm, rnf163, xcnbp, zcchc22, znf9
Gene Name: CCHC-type zinc finger nucleic acid binding protein
Description: E3 ubiquitin ligase
Plate: GDExt11007 Well: C03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133230.1
ORF Translation: ATO94582.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis CCHC-type zinc finger, nucleic acid binding protein, mRNA (cDNA clone MGC:69190 IMAGE:5307256), complete cds
Template Accession: BC074704
GI: 49257795
Clone ID: IMAGE:5307256
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAGCAACGAGTGCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCCGTGGCTTCGATCGT


Publications
First:
Most recent:
View All Papers