Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19760516

Xenopus ORFeome
What is the ORFeome?

ORF Name:cndp2 ORF1 Species: tropicalis
Gene Symbol: cndp2 Entrez Gene ID: 394907
Gene Synonyms: cn2, cpgl, darmin-r, darmin-related
Gene Name: CNDP dipeptidase 2 (metallopeptidase M20 family)
Description: metallopeptidase
Plate: GDExt11003 Well: B03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132846.1
ORF Translation: ATO94198.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis CNDP dipeptidase 2 (metallopeptidase M20 family), mRNA (cDNA clone MGC:75655 IMAGE:5379710), complete cds
Template Accession: BC064175
GI: 39795552
Clone ID: IMAGE:5379710
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGTTCTGCAAACCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCAGGTTGGAGACTTCAT


Publications
First:
Most recent:
View All Papers