Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761317

Xenopus ORFeome
What is the ORFeome?

ORF Name:cyth3 ORF1 Species: tropicalis
Gene Symbol: cyth3 Entrez Gene ID: 780343
Gene Synonyms: pscd3
Gene Name: cytohesin 3
Description: Guanine nucleotide exchange factor Cytohesin, contains PH and Sec7 domains
Plate: GDExt11028 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135030.1
ORF Translation: ATO96382.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC145373, mRNA (cDNA clone MGC:145373 IMAGE:7677034), complete cds
Template Accession: BC125677
GI: 116487433
Clone ID: IMAGE:7677034
Tissue: testis
Stage:
Clone Library: NIH_XGC_tropTe3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGAGACGGAGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTATTGGCGATTCTCCTCTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556