Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761322

Xenopus ORFeome
What is the ORFeome?

ORF Name:dach2 ORF1 Species: tropicalis
Gene Symbol: dach2 Entrez Gene ID: 100101662
Gene Synonyms:
Gene Name: dachshund family transcription factor 2
Description: transcriptional regulator
Plate: GDExt11046 Well: B09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136507.1
ORF Translation: ATO97859.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis dachshund homolog 2, mRNA (cDNA clone MGC:172589 IMAGE:7653484), complete cds
Template Accession: BC153333
GI: 157422845
Clone ID: IMAGE:7653484
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGTGTCTGCACCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACATTATTGGTGGCTTTATGTA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.2


Major funding for Xenbase is provided by grant P41 HD064556