Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761332

Xenopus ORFeome
What is the ORFeome?

ORF Name:dao ORF1 Species: tropicalis
Gene Symbol: dao Entrez Gene ID: 100036595
Gene Synonyms:
Gene Name: D-amino-acid oxidase
Description: D-aspartate oxidase
Plate: GDExt11013 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133778.1
ORF Translation: ATO95130.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100036595, mRNA (cDNA clone MGC:79809 IMAGE:6986623), complete cds
Template Accession: BC080368
GI: 111598522
Clone ID: IMAGE:6986623
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCACATAACTATTATTGGAGCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGGAAGACTTAGGAGTCTCTTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.2


Major funding for Xenbase is provided by grant P41 HD064556