Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761337

Xenopus ORFeome
What is the ORFeome?

ORF Name:dap ORF1 Species: tropicalis
Gene Symbol: dap Entrez Gene ID: 549918
Gene Synonyms:
Gene Name: death-associated protein
Description:
Plate: GDExt11024 Well: G04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134720.1
ORF Translation: ATO96072.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis death-associated protein, mRNA (cDNA clone MGC:108086 IMAGE:7004447), complete cds
Template Accession: BC096501
GI: 66792592
Clone ID: IMAGE:7004447
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTCTCCTCCCAAAGAGAAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGCGGGGCTGATGGA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556