Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761482

Xenopus ORFeome
What is the ORFeome?

ORF Name:ddc ORF1 Species: tropicalis
Gene Symbol: ddc Entrez Gene ID: 496742
Gene Synonyms:
Gene Name: dopa decarboxylase
Description: Aromatic-L-amino-acid/L-histidine decarboxylase
Plate: GDExt11026 Well: E09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134969.1
ORF Translation: ATO96321.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical LOC496742, mRNA (cDNA clone MGC:107923 IMAGE:7024441), complete cds
Template Accession: BC088004
GI: 56789300
Clone ID: IMAGE:7024441
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGCTTCCGAATTCAGAAAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCCGAGCTTTTTGCTGTTCTT


Publications
First:
Most recent:
View All Papers