Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761642

Xenopus ORFeome
What is the ORFeome?

ORF Name:dhrs13 ORF1 Species: tropicalis
Gene Symbol: dhrs13 Entrez Gene ID: 394935
Gene Synonyms:
Gene Name: dehydrogenase/reductase (SDR family) member 13
Description: Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases)
Plate: GDExt11002 Well: B01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132803.1
ORF Translation: ATO94155.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC76232, mRNA (cDNA clone MGC:76232 IMAGE:5336576), complete cds
Template Accession: BC063926
GI: 39794428
Clone ID: IMAGE:5336576
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTACCGGTGATGCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGGCCAATCCGGTCATCCT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556