Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761687

Xenopus ORFeome
What is the ORFeome?

ORF Name:dll1 ORF1 Species: tropicalis
Gene Symbol: dll1 Entrez Gene ID: 100101697
Gene Synonyms: delta-1, delta-1, delta1, x-delta, x-delta-1, xdelta-1, xdelta1, xdelta1
Gene Name: delta-like 1
Description: signal transduction/notch signaling pathway
Plate: GDExt11043 Well: C01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136130.1
ORF Translation: ATO97482.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis delta-like 1, mRNA (cDNA clone MGC:121362 IMAGE:7605672), complete cds
Template Accession: BC135592
GI: 134254208
Clone ID: IMAGE:7605672
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACAGCAATGCATGCTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCTCTGTTGCAATGATG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556