Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761934

Xenopus ORFeome
What is the ORFeome?

ORF Name:dtl ORF1 Species: tropicalis
Gene Symbol: dtl Entrez Gene ID: 395039
Gene Synonyms: cdt2, dcaf2, l2dtl, ramp
Gene Name: denticleless E3 ubiquitin protein ligase homolog
Description: WD40 repeat-containing protein L2DTL
Plate: GDExt11002 Well: G04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132795.1
ORF Translation: ATO94147.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis denticleless homolog (Drosophila), mRNA (cDNA clone MGC:75574 IMAGE:5379105), complete cds
Template Accession: BC064851
GI: 40674502
Clone ID: IMAGE:5379105
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGTTTCGATCTGTGGTAAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGGATTTCTTAAAGAAGTAGGT


Publications
First:
Most recent:
View All Papers