Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762004

Xenopus ORFeome
What is the ORFeome?

ORF Name:dvl2 ORF1 Species: tropicalis
Gene Symbol: dvl2 Entrez Gene ID: 780117
Gene Synonyms: dishevelled, dsh, dvl, xdsh
Gene Name: dishevelled segment polarity protein 2
Description: wnt signal transduction
Plate: GDExt11030 Well: C10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135205.1
ORF Translation: ATO96557.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis dishevelled, dsh homolog 2, mRNA (cDNA clone MGC:146359 IMAGE:7693791), complete cds
Template Accession: BC123948
GI: 116284128
Clone ID: IMAGE:7693791
Tissue: testis
Stage: frog
Clone Library: NIH_XGC_tropTe4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGACTAAAGTCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGACATCCACAAAGAACTC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556