Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762089

Xenopus ORFeome
What is the ORFeome?

ORF Name:edar ORF1 Species: tropicalis
Gene Symbol: edar Entrez Gene ID: 448544
Gene Synonyms:
Gene Name: ectodysplasin A receptor
Description:
Plate: GDExt11016 Well: D10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134074.1
ORF Translation: ATO95426.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ectodysplasin A receptor, mRNA (cDNA clone MGC:88893 IMAGE:6998530), complete cds
Template Accession: BC076874
GI: 49900166
Clone ID: IMAGE:6998530
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACCAATCAAGTGACAGAAAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGAGCTTTCATTTTTGGGTAAAGA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556