Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762134

Xenopus ORFeome
What is the ORFeome?

ORF Name:eef1g ORF1 Species: tropicalis
Gene Symbol: eef1g Entrez Gene ID: 394875
Gene Synonyms: eef1g-a, eef1g-b, ef1g, gig35
Gene Name: eukaryotic translation elongation factor 1 gamma
Description: Translation elongation factor EF-1 gamma
Plate: GDExt11002 Well: B06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132802.1
ORF Translation: ATO94154.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC76278, mRNA (cDNA clone MGC:76278 IMAGE:5379330), complete cds
Template Accession: BC064264
GI: 39795849
Clone ID: IMAGE:5379330
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAATACAATAAGCAGGCCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGAAGATCTTGCCCTGGT


Publications
First:
Most recent:
View All Papers