Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762184

Xenopus ORFeome
What is the ORFeome?

ORF Name:efnb3 ORF1 Species: tropicalis
Gene Symbol: efnb3 Entrez Gene ID: 100127666
Gene Synonyms: eb3, efl6, ephrin b3, ephrinb3, eplg8, lerk8
Gene Name: ephrin-B3
Description: ligand for Eph receptor tyrosine kinase
Plate: GDExt11046 Well: G09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136498.1
ORF Translation: ATO97850.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100127666, mRNA (cDNA clone MGC:173041 IMAGE:7658167), complete cds
Template Accession: BC154105
GI: 158253668
Clone ID: IMAGE:7658167
Tissue: brain
Stage:
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCCCCCGGGAGCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTTTGTAGTAGATGTTGGCAGG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556