Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762309

Xenopus ORFeome
What is the ORFeome?

ORF Name:eif4e2 ORF1 Species: tropicalis
Gene Symbol: eif4e2 Entrez Gene ID: 548830
Gene Synonyms:
Gene Name: eukaryotic translation initiation factor 4E family member 2
Description: Predicted mRNA cap-binding protein related to eIF-4E
Plate: GDExt11035 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135578.1
ORF Translation: ATO96930.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis eukaryotic translation initiation factor 4E member 2, mRNA (cDNA clone MGC:146916 IMAGE:7842894), complete cds
Template Accession: BC121524
GI: 111307936
Clone ID: IMAGE:7842894
Tissue: stomach
Stage:
Clone Library: NIH_XGC_tropSto1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTTTGTCTGGACAGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATACCGTGATCTTTGTGTTACGGAA


Publications
First:
Most recent:
View All Papers