Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762344

Xenopus ORFeome
What is the ORFeome?

ORF Name:elavl3 ORF1 Species: tropicalis
Gene Symbol: elavl3 Entrez Gene ID: 594912
Gene Synonyms: elrc, huc
Gene Name: ELAV like neuron-specific RNA binding protein 3
Description: RNA binding
Plate: GDExt11039 Well: E08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135844.1
ORF Translation: ATO97196.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ELAV (embryonic lethal, abnormal vision)-like 3 (Hu antigen C), mRNA (cDNA clone MGC:122906 IMAGE:7668020), complete cds
Template Accession: BC136134
GI: 134026263
Clone ID: IMAGE:7668020
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGACTCAGATAATCAGCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCCTTGTGCTGTTTACT


Publications
First:
Most recent:
View All Papers