Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762349

Xenopus ORFeome
What is the ORFeome?

ORF Name:elavl3 ORF2 Species: tropicalis
Gene Symbol: ccdc3 Entrez Gene ID: 549857
Gene Synonyms:
Gene Name: coiled-coil domain containing 3
Description: Myosin class II heavy chain
Plate: GDExt11039 Well: D12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135892.1
ORF Translation: ATO97244.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis cDNA clone MGC:122930 IMAGE:7669420, complete cds
Template Accession: BC136173
GI: 134026269
Clone ID: IMAGE:7669420
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAGGGGGACCTTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTTTTAGGTATGTTGAATGA


Publications
First:
Most recent:
View All Papers