Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762354

Xenopus ORFeome
What is the ORFeome?

ORF Name:elavl4 ORF1 Species: tropicalis
Gene Symbol: elavl4 Entrez Gene ID: 100125165
Gene Synonyms: elrd, elrd1, elrd2, hud
Gene Name: ELAV like neuron-specific RNA binding protein 4
Description: RNA binding
Plate: GDExt11045 Well: F02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136363.1
ORF Translation: ATO97715.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100125165, mRNA (cDNA clone MGC:121599 IMAGE:7622458), complete cds
Template Accession: BC135736
GI: 138519952
Clone ID: IMAGE:7622458
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTGGAATGGCTTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTTGTGGGTTTTGTTGGTT


Publications
First:
Most recent:
View All Papers