Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762369

Xenopus ORFeome
What is the ORFeome?

ORF Name:elk3 ORF1 Species: tropicalis
Gene Symbol: elk3 Entrez Gene ID: 780055
Gene Synonyms: erp, sap2
Gene Name: ELK3, ETS transcription factor
Description: transcription factor
Plate: GDExt11029 Well: E11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135131.1
ORF Translation: ATO96483.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ELK3, ETS-domain protein (SRF accessory protein 2), mRNA (cDNA clone MGC:146246 IMAGE:7688861), complete cds
Template Accession: BC122973
GI: 114108006
Clone ID: IMAGE:7688861
Tissue: testis
Stage: frog
Clone Library: NIH_XGC_tropTe4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAGTGCAATCACACTGTGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATTTGTGGGTGTTGGATG


Publications
First:
Most recent:
View All Papers